Company Profile
The Midland Certified Reagent Company, Inc. is a well-established chemical company headquartered in the United States. It specializes in the production and distribution of high-quality reagents for a wide range of applications, including laboratory research, biochemical studies, and environmental analysis.
Founded in 1973, Midland has earned a reputation as a trusted partner for scientists and researchers worldwide, providing reliable and consistent reagents that meet the highest standards of quality and purity. The company's commitment to excellence is demonstrated through rigorous quality control processes and an extensive range of reagents, covering basic chemicals, specialized reagents, and those tailored to specific research areas.
Midland's strength lies in its ability to customize reagents to meet the unique requirements of its customers. Whether modifying the composition of a reagent, developing a new reagent for specific research needs, or providing personalized packaging and labeling, Midland possesses the expertise and resources to deliver tailored solutions.
Beyond its focus on producing high-quality reagents, Midland is dedicated to sustainability and environmental responsibility. The company strives to minimize its impact on the environment by adopting responsible packaging and waste disposal practices, utilizing eco-friendly products and packaging, and promoting sustainable reagents and research practices.
As a leader in the field of chemical reagents, Midland is committed to offering the highest level of quality and service to its customers. Through customized solutions, environmental responsibility, and exceptional customer service, Midland aims to support scientists and researchers in advancing the boundaries of knowledge in chemistry.
VIEW MORE VIEW LESS
Product List
| Product Name | Synonyms | CAS No. | Grate/Content | Operate |
|---|---|---|---|---|
ATGCGTCCGGCGTAGA |
D(ATGCGTCCGGCGTAGA);ATGCGTCCGGCGTAGA;PBR322 BAM HI,CCW;PRIMER PBR322 (BAMH I), COUNTERCLOCKWISE, 16-MER;PET UPSTREAM PRIMER;primer pbr322 (bamh I)*counterclockwise;5'-atg cgt ccg gcg tag a-3';pbr322 (bamh i) sequencing primer, counterclockwise, 16-mer |
119112-08-2 | Inquiry | |
D(GCAATTTAACTGTGAT) |
GCAATTTAACTGTGAT;D(GCAATTTAACTGTGAT);PBR322 HIND III,CCW;5'-gca att taa ctg tga t-3';primer pbr322 (hind iii)*counterclockwise;PRIMER PBR322 (HIND III), COUNTERCLOCKWISE, 16-MER;pbr322 (hind iii) sequencing primer, counterclockwise, 16-mer |
81412-70-6 | Inquiry | |
D(GGTGGCGACGACTCCTGGAGCCCG) |
GGTGGCGACGACTCCTGGAGCCCG;D(GGTGGCGACGACTCCTGGAGCCCG);LAMBDA GT11 (FORWARD);LAMBDA GT11 PRIMER, FORWARD, 24-MER;5μ-GGTGGCGACGACTCCTGGAGCCCG-3μ |
139528-83-9 | Inquiry | |
D(GTATCACGAGGCCCTT) |
GTATCACGAGGCCCTT;D(GTATCACGAGGCCCTT);PBR322 ECO RI,CW;PRIMER PBR322 (ECOR I), CLOCKWISE, 16-MER;5'-gta tca cga ggc cct t-3';pbr322 (ecor i) sequencing primer, clockwise, 16-mer |
78169-78-5 | Inquiry | |
DNA polymerase |
DNA-dependent DNA polymerase;Nucleotidyltransferase,deoxyribonucleate;DNA nucleotidyltransferase;DNA polymerase;Deoxyribonucleic polymerase I;Deoxyribonucleic polymerase;Deoxyribonucleate nucleotidyltransferase;E.C. 2.7.7.7;Deoxyribonucleic acid polymerase I;Duplicase;Deoxyribonucleic duplicase;DNA duplicase;Deoxyribonucleate polymerase;Deoxyribonucleic acid polymerase;DNA-directed DNA polymerase;DNA replicase;DNA-dependent DNA polymerase I;Thermo Sequenase;Taquenase;Proteins,gene polA;Vent DNA polymerase;AcycloPol;Deoxyribonucleotide polymerase;Family A DNA polymerase;VENT polymerase;Tgo DNA polymerase;13: PN: WO2013116591 PAGE: 71 claimed sequence;DNA-dependent DNA polymerases;Terra PCR Direct Polymerase;Z-Taq polymerase;Phanta Super-Fidelity DNA polymerase;AccuPrimePfx;Therminator DNA polymerase;Herculase II Fusion DNA Polymerase;9026-79-3;9045-34-5 |
9012-90-2 | Inquiry | |
TERMINAL DEOXYNUCLEOTIDYL TRANSFERASE |
Terminal deoxyribonucleotidyltransferase;Nucleotidyltransferase,terminal deoxyribo-;E.C. 2.7.7.31;Addase;DNA nucleotidylexotransferase;Deoxyribonucleic nucleotidylexotransferase;Deoxyribonucleic acid nucleotidylexotransferase;Terminal deoxynucleotidyltransferase;Deoxynucleotidyl terminal transferase;Terminal deoxynucleotide transferase;TdT;Terminal transferase;DNA terminal transferase;Terminal deoxynucleoside transferase |
9027-67-2 | Inquiry |