On ECHEMI

The Midland Certified Reagent Company, Inc.

United States
Favorite Supplier
 341 people visit

Company Profile

The Midland Certified Reagent Company, Inc. is a well-established chemical company headquartered in the United States. It specializes in the production and distribution of high-quality reagents for a wide range of applications, including laboratory research, biochemical studies, and environmental analysis.


Founded in 1973, Midland has earned a reputation as a trusted partner for scientists and researchers worldwide, providing reliable and consistent reagents that meet the highest standards of quality and purity. The company's commitment to excellence is demonstrated through rigorous quality control processes and an extensive range of reagents, covering basic chemicals, specialized reagents, and those tailored to specific research areas.


Midland's strength lies in its ability to customize reagents to meet the unique requirements of its customers. Whether modifying the composition of a reagent, developing a new reagent for specific research needs, or providing personalized packaging and labeling, Midland possesses the expertise and resources to deliver tailored solutions.


Beyond its focus on producing high-quality reagents, Midland is dedicated to sustainability and environmental responsibility. The company strives to minimize its impact on the environment by adopting responsible packaging and waste disposal practices, utilizing eco-friendly products and packaging, and promoting sustainable reagents and research practices.


As a leader in the field of chemical reagents, Midland is committed to offering the highest level of quality and service to its customers. Through customized solutions, environmental responsibility, and exceptional customer service, Midland aims to support scientists and researchers in advancing the boundaries of knowledge in chemistry.


VIEW MORE VIEW LESS

Product List

Product Name Synonyms CAS No. Grate/Content Operate

ATGCGTCCGGCGTAGA

D(ATGCGTCCGGCGTAGA);ATGCGTCCGGCGTAGA;PBR322 BAM HI,CCW;PRIMER PBR322 (BAMH I), COUNTERCLOCKWISE, 16-MER;PET UPSTREAM PRIMER;primer pbr322 (bamh I)*counterclockwise;5'-atg cgt ccg gcg tag a-3';pbr322 (bamh i) sequencing primer, counterclockwise, 16-mer
119112-08-2 Inquiry

D(GCAATTTAACTGTGAT)

GCAATTTAACTGTGAT;D(GCAATTTAACTGTGAT);PBR322 HIND III,CCW;5'-gca att taa ctg tga t-3';primer pbr322 (hind iii)*counterclockwise;PRIMER PBR322 (HIND III), COUNTERCLOCKWISE, 16-MER;pbr322 (hind iii) sequencing primer, counterclockwise, 16-mer
81412-70-6 Inquiry

D(GGTGGCGACGACTCCTGGAGCCCG)

GGTGGCGACGACTCCTGGAGCCCG;D(GGTGGCGACGACTCCTGGAGCCCG);LAMBDA GT11 (FORWARD);LAMBDA GT11 PRIMER, FORWARD, 24-MER;5μ-GGTGGCGACGACTCCTGGAGCCCG-3μ
139528-83-9 Inquiry

D(GTATCACGAGGCCCTT)

GTATCACGAGGCCCTT;D(GTATCACGAGGCCCTT);PBR322 ECO RI,CW;PRIMER PBR322 (ECOR I), CLOCKWISE, 16-MER;5'-gta tca cga ggc cct t-3';pbr322 (ecor i) sequencing primer, clockwise, 16-mer
78169-78-5 Inquiry

DNA polymerase

DNA-dependent DNA polymerase;Nucleotidyltransferase,deoxyribonucleate;DNA nucleotidyltransferase;DNA polymerase;Deoxyribonucleic polymerase I;Deoxyribonucleic polymerase;Deoxyribonucleate nucleotidyltransferase;E.C. 2.7.7.7;Deoxyribonucleic acid polymerase I;Duplicase;Deoxyribonucleic duplicase;DNA duplicase;Deoxyribonucleate polymerase;Deoxyribonucleic acid polymerase;DNA-directed DNA polymerase;DNA replicase;DNA-dependent DNA polymerase I;Thermo Sequenase;Taquenase;Proteins,gene polA;Vent DNA polymerase;AcycloPol;Deoxyribonucleotide polymerase;Family A DNA polymerase;VENT polymerase;Tgo DNA polymerase;13: PN: WO2013116591 PAGE: 71 claimed sequence;DNA-dependent DNA polymerases;Terra PCR Direct Polymerase;Z-Taq polymerase;Phanta Super-Fidelity DNA polymerase;AccuPrimePfx;Therminator DNA polymerase;Herculase II Fusion DNA Polymerase;9026-79-3;9045-34-5
9012-90-2 Inquiry

TERMINAL DEOXYNUCLEOTIDYL TRANSFERASE

Terminal deoxyribonucleotidyltransferase;Nucleotidyltransferase,terminal deoxyribo-;E.C. 2.7.7.31;Addase;DNA nucleotidylexotransferase;Deoxyribonucleic nucleotidylexotransferase;Deoxyribonucleic acid nucleotidylexotransferase;Terminal deoxynucleotidyltransferase;Deoxynucleotidyl terminal transferase;Terminal deoxynucleotide transferase;TdT;Terminal transferase;DNA terminal transferase;Terminal deoxynucleoside transferase
9027-67-2 Inquiry

CONTACT INFORMATION

Send an inquiry

Product Name:
Quantity:
Shipment Term:

United States

  • China
  • Albania
  • Algeria
  • Angola
  • Anguilla
  • Antigua and Barbuda
  • Argentina
  • Armenia
  • Aruba
  • Australia
  • Austria
  • Azerbaijan
  • Bahamas
  • Bahrain
  • Bangladesh
  • Barbados
  • Belgium
  • Belize
  • Benin
  • Bermuda
  • Bhutan
  • Bolivia
  • Bosnia and Herzegovina
  • Botswana
  • Brazil
  • Brunei
  • Bulgaria
  • Burkina-faso
  • Burundi
  • Cameroon
  • Canada
  • Cape Verde
  • Cayman Islands
  • Central African
  • Chad
  • Chile
  • Colombia
  • Comoros
  • Cook Is.
  • Costa Rica
  • Croatia
  • Curacao
  • Cyprus
  • Czech
  • Democratic Republic of the Congo
  • Denmark
  • Djibouti
  • Dominica
  • Ecuador
  • Egypt
  • El Salvador
  • Equatorial Guinea
  • Eritrea
  • Estonia
  • Ethiopia
  • Faroe Islands
  • Fiji
  • Finland
  • France
  • French Guiana
  • French Polynesia
  • Gabon
  • Gambia
  • Georgia
  • Germany
  • Ghana
  • Gibraltar
  • Greece
  • Greenland
  • Grenada
  • Guadeloupe
  • Guam
  • Guatemala
  • Guinea
  • Guinea-Bissau
  • Guyana
  • Haiti
  • Honduras
  • Hongkong, China
  • Hungary
  • Iceland
  • India
  • Indonesia
  • Ireland
  • Israel
  • Italy
  • Ivory Coast
  • Jamaica
  • Japan
  • Jordan
  • Kampuchea (Cambodia )
  • Kazakstan
  • Kenya
  • Kiribati
  • Kosovo
  • Kuwait
  • Kyrgyzstan
  • Laos
  • Latvia
  • Lebanon
  • Lesotho
  • Liberia
  • Liechtenstein
  • Lithuania
  • Luxembourg
  • Macao, China
  • Madagascar
  • Malawi
  • Malaysia
  • Maldives
  • Mali
  • Malta
  • Marshall Island
  • Martinique
  • Mauritania
  • Mauritius
  • Mayotte
  • Mexico
  • Micronesia
  • Moldova
  • Monaco
  • Mongolia
  • Montenegro
  • Montserrat
  • Morocco
  • Mozambique
  • Myanmar
  • Namibia
  • Nauru
  • Nepal
  • Netherlands
  • Netherlands Antilles
  • New Caledonia
  • New Zealand
  • Nicaragua
  • Niger
  • Nigeria
  • Norfolk Island
  • North Macedonia
  • Norway
  • Oman
  • Pakistan
  • Palau
  • Palestine
  • Panama
  • Papua New Cuinea
  • Paraguay
  • Peru
  • Philippines
  • Poland
  • Portugal
  • Puerto Rico
  • Qatar
  • Republic of the Congo
  • Reunion Island
  • Romania
  • Russia
  • Rwanda
  • Saint Kitts and Nevis
  • Saint Martin
  • Saint Vincent and the Grenadines
  • Samoa
  • San Marino
  • Sao Tome and Principe
  • Saudi Arabia
  • Senegal
  • Serbia
  • Seychelles
  • Sierra Leone
  • Singapore
  • Slovakia
  • Slovenia
  • Solomon Is
  • Somali
  • South Africa
  • South Korea
  • South Sudan
  • Spain
  • Sri Lanka
  • St.Lucia
  • Suriname
  • Swaziland
  • Sweden
  • Switzerland
  • Taiwan, China
  • Tajikstan
  • Tanzania
  • Thailand
  • The British Virgin Islands
  • The Dominican Republic
  • The Islamic Republic of Mauritania
  • The Islands of st pierre and miquelon
  • The Turks and Caicos Islands
  • Timor-Leste
  • Togo
  • Tonga
  • Trinidad and Tobago
  • Tunisia
  • Turkey
  • Turkmenistan
  • Tuvalu
  • Uganda
  • United Arab Emirates
  • United Kingdom
  • United States
  • Uruguay
  • Uzbekistan
  • Vanuatu
  • Vatican
  • Vietnam
  • Wallis et Futuna
  • Western Sahara
  • Yemen
  • Zaire
  • Zambia
  • Zimbabwe
  • Afghanistan
  • Belarus
  • Cuba
  • Iran
  • Iraq
  • Libya
  • North Korea
  • Sudan
  • Syria
  • Ukraine
  • Venezuela
Message:
0/2000
Accept quotations from other qualified suppliers on ECHEMI.com

All products displayed on this website are only for non-medical purposes such as industrial applications or scientific research, and cannot be used for clinical diagnosis or treatment of humans or animals. They are not medicinal or edible.

According to relevant laws and regulations and the regulations of this website, units or individuals who purchase hazardous materials should obtain valid qualifications and qualification conditions.

The information shown above is provided by the enterprise itself, and the authenticity, accuracy and legitimacy of the content are the responsibility of the publishing company. ECHEMI does not bear any guarantee responsibility for this. Please be aware that risks in internet transactions objectively exist.

Feedback & Suggestions
Send Message

Thank you for your feedback. If you require further assistance, please contact us by email at info@echemi.com or call us at +86-532-55729510.