On ECHEMI

FreeHand Enterprise

Austria
Favorite Supplier
 174 people visit

Product List

Product Name Synonyms CAS No. Grate/Content Operate

1,8-Dihydroxy-anthrone

9(10H)-Anthracenone,1,8-dihydroxy-;Anthrone,1,8-dihydroxy-;1,8-Dihydroxy-9(10H)-anthracenone;1,8-Dihydroxyanthrone;1,8-Dihydroxy-9-anthrone;Anthra-Derm;Anthralin;Chrysodermol;Cigthranol;Dithranol;Psoriacid-Stift;Cignolin;Batridol;Lasan;Batidrol;DrithoCreme;Drithoscalp;Psodadrate;Psoriacide;NSC 43970;NSC 629313;Derobin;1,8-Dihydroxy-10H-anthracen-9-one;1,8-Dihydroxy-9,10-dihydroanthracen-9-one
1143-38-0 - / 99% Inquiry

Aripiprazole

2(1H)-Quinolinone,7-[4-[4-(2,3-dichlorophenyl)-1-piperazinyl]butoxy]-3,4-dihydro-;7-[4-[4-(2,3-Dichlorophenyl)-1-piperazinyl]butoxy]-3,4-dihydro-2(1H)-quinolinone;OPC 14597;Aripiprazole;OPC 31;7-[4-[4-(2,3-Dichlorophenyl)-1-piperazinyl]butoxy]-3,4-dihydrocarbostyril;Abilitat;Abilify;Arpizol;Asprito;Pripiprazole;Aripiperazole;Aripirazole;Aripiprazol;Aristab;Biopiprazole;AZ 1;AZ 2;AZ 3;AZ 4;156680-99-8
129722-12-9 - / 99% Inquiry

DNA,d(G-G-T-G-G-C-G-A-C-G-A-C-T-C-C-T-G-G-A-G-C-C-C-G) (9CI)

GGTGGCGACGACTCCTGGAGCCCG;D(GGTGGCGACGACTCCTGGAGCCCG);LAMBDA GT11 (FORWARD);LAMBDA GT11 PRIMER, FORWARD, 24-MER;5μ-GGTGGCGACGACTCCTGGAGCCCG-3μ
139528-83-9 - / 99% Inquiry

Ethenesulfonic acid homopolymer

Ethenesulfonic acid,sodium salt (1:1),homopolymer;Ethenesulfonic acid,sodium salt,polymers;Ethenesulfonic acid,sodium salt,homopolymer;Polyethylenesulfonate sodium;Poly(sodium vinylsulfonate);Vinylsulfonic acid polymer sodium salt;Sodium vinylsulfonate polymer;Poly(sodium ethylenesulfonate);Sodium vinylsulfonate homopolymer;850693-47-9
9002-97-5 - / 99% Inquiry

Pramipexole

2,6-Benzothiazolediamine,4,5,6,7-tetrahydro-N6-propyl-,(6S)-;2,6-Benzothiazolediamine,4,5,6,7-tetrahydro-N6-propyl-,(S)-;(6S)-4,5,6,7-Tetrahydro-N6-propyl-2,6-benzothiazolediamine;Pramipexole;SND 919;SUD 919CL2Y;U 98528E;(-)-Pramipexole;(S)-2-Amino-6-propylamino-4,5,6,7-tetrahydrobenzothiazole;(S)-Pramipexole;6-Propylamino-4,5,6,7-tetrahydro-1,3-benzothiazole-2-amine;(6S)-N6-Propyl-4,5,6,7-tetrahydro-1,3-benzothiazole-2,6-diamine;(6S)-6-N-Propyl-4,5,6,7-tetrahydro-1,3-benzothiazole-2,6-diamine
104632-26-0 - / 99% Inquiry

Stearic acid

Octadecanoic acid;Stearic acid;Kam 1000;Kam 2000;Kam 3000;1-Heptadecanecarboxylic acid;Neo-Fat 18-59;Neo-Fat 18-53;Neo-Fat 18-54;Stearex Beads;Stearophanic acid;Hydrofol Acid 150;PD 185;Hystrene S 97;Hystrene T 70;Hystrene 80;Vanicol;Humko Industrene R;NAA 173;Neo-Fat 18;n-Octadecanoic acid;Industrene R;Barolub FTA;Loxiol G 20;Lunac S 20;Century 1210;Century 1220;Century 1230;Century 1240;Emersol 6349;Neo-Fat 18S;Selosol 920;Hystrene 9718NFFG;Hydrofol Acid 1895;17FA;A 1760;Pristerene 4900;Lunac S 90;Lunac S 40;NAA 180;Sunfat 18S;Norsorex AP;Lunac S 90KC;Lunac S 30;Emersol 153NF;Edenor ST 1;Edenor ST 20;Lunac 30;Hystrene 9718NF;Industrene 8718;400JB9103-88;Nopcocera LU 6418;Kortacid 1895;Adeka Fatty Acid SA 910;S 30C;S 30C (fatty acid);Lunac YA;WO 2;WO 2 (fatty acid);Radiacid 0427;Hystrene 9718;Lunac S 98;Emersol 120;Industrene 9018;F 3;F 3 (lubricant);SA 200;Edenor HT-JG 60;VLZ 200;Lunac S 50;Pristerene 9559;Edenor C 18/98;NAA 175S;Prifac 2918;Pristerene 4963;S 300;S 300 (fatty acid);G 270;TST;NAA 175;Nissan Unister NAA 180;Unister NAA 180;FA 1655;NSC 25956;NSC 261168;Pristerene 9429;Edenor C 18;Stearic Acid Cherry;Vis-Plus;Industrene 5016K;Hystrene 5016;SA 400 (fatty acid);SA 400;V 1890;Industrene 5016;Kortacid 1989;SA 1801;Dervacid 3155;Prifac 2979;Prifac 2981;S 40T;Tsubaki;NAA 173K;Kiri stearic acid;Prifrac 2981;Century 1224;NAA 180P;T 18;Lunac S 25;Radiacid 0152;F 1500;G 20;8013-28-3;8023-06-1;8037-40-9;8037-83-0;8039-51-8;8039-52-9;8039-53-0;8039-54-1;39390-61-9;58392-66-8;82497-27-6;134503-33-6;197923-10-7;294203-07-9;294203-15-9;1245726-94-6;1429745-84-5
57-11-4 - / 99% Inquiry

CONTACT INFORMATION

Send an inquiry

Product Name:
Quantity:
Shipment Term:

United States

  • China
  • Albania
  • Algeria
  • Angola
  • Anguilla
  • Antigua and Barbuda
  • Argentina
  • Armenia
  • Aruba
  • Australia
  • Austria
  • Azerbaijan
  • Bahamas
  • Bahrain
  • Bangladesh
  • Barbados
  • Belgium
  • Belize
  • Benin
  • Bermuda
  • Bhutan
  • Bolivia
  • Bosnia and Herzegovina
  • Botswana
  • Brazil
  • Brunei
  • Bulgaria
  • Burkina-faso
  • Burundi
  • Cameroon
  • Canada
  • Cape Verde
  • Cayman Islands
  • Central African
  • Chad
  • Chile
  • Colombia
  • Comoros
  • Cook Is.
  • Costa Rica
  • Croatia
  • Curacao
  • Cyprus
  • Czech
  • Democratic Republic of the Congo
  • Denmark
  • Djibouti
  • Dominica
  • Ecuador
  • Egypt
  • El Salvador
  • Equatorial Guinea
  • Eritrea
  • Estonia
  • Ethiopia
  • Faroe Islands
  • Fiji
  • Finland
  • France
  • French Guiana
  • French Polynesia
  • Gabon
  • Gambia
  • Georgia
  • Germany
  • Ghana
  • Gibraltar
  • Greece
  • Greenland
  • Grenada
  • Guadeloupe
  • Guam
  • Guatemala
  • Guinea
  • Guinea-Bissau
  • Guyana
  • Haiti
  • Honduras
  • Hongkong, China
  • Hungary
  • Iceland
  • India
  • Indonesia
  • Ireland
  • Israel
  • Italy
  • Ivory Coast
  • Jamaica
  • Japan
  • Jordan
  • Kampuchea (Cambodia )
  • Kazakstan
  • Kenya
  • Kiribati
  • Kosovo
  • Kuwait
  • Kyrgyzstan
  • Laos
  • Latvia
  • Lebanon
  • Lesotho
  • Liberia
  • Liechtenstein
  • Lithuania
  • Luxembourg
  • Macao, China
  • Madagascar
  • Malawi
  • Malaysia
  • Maldives
  • Mali
  • Malta
  • Marshall Island
  • Martinique
  • Mauritania
  • Mauritius
  • Mayotte
  • Mexico
  • Micronesia
  • Moldova
  • Monaco
  • Mongolia
  • Montenegro
  • Montserrat
  • Morocco
  • Mozambique
  • Myanmar
  • Namibia
  • Nauru
  • Nepal
  • Netherlands
  • Netherlands Antilles
  • New Caledonia
  • New Zealand
  • Nicaragua
  • Niger
  • Nigeria
  • Norfolk Island
  • North Macedonia
  • Norway
  • Oman
  • Pakistan
  • Palau
  • Palestine
  • Panama
  • Papua New Cuinea
  • Paraguay
  • Peru
  • Philippines
  • Poland
  • Portugal
  • Puerto Rico
  • Qatar
  • Republic of the Congo
  • Reunion Island
  • Romania
  • Russia
  • Rwanda
  • Saint Kitts and Nevis
  • Saint Martin
  • Saint Vincent and the Grenadines
  • Samoa
  • San Marino
  • Sao Tome and Principe
  • Saudi Arabia
  • Senegal
  • Serbia
  • Seychelles
  • Sierra Leone
  • Singapore
  • Slovakia
  • Slovenia
  • Solomon Is
  • Somali
  • South Africa
  • South Korea
  • South Sudan
  • Spain
  • Sri Lanka
  • St.Lucia
  • Suriname
  • Swaziland
  • Sweden
  • Switzerland
  • Taiwan, China
  • Tajikstan
  • Tanzania
  • Thailand
  • The British Virgin Islands
  • The Dominican Republic
  • The Islamic Republic of Mauritania
  • The Islands of st pierre and miquelon
  • The Turks and Caicos Islands
  • Timor-Leste
  • Togo
  • Tonga
  • Trinidad and Tobago
  • Tunisia
  • Turkey
  • Turkmenistan
  • Tuvalu
  • Uganda
  • United Arab Emirates
  • United Kingdom
  • United States
  • Uruguay
  • Uzbekistan
  • Vanuatu
  • Vatican
  • Vietnam
  • Wallis et Futuna
  • Western Sahara
  • Yemen
  • Zaire
  • Zambia
  • Zimbabwe
  • Afghanistan
  • Belarus
  • Cuba
  • Iran
  • Iraq
  • Libya
  • North Korea
  • Sudan
  • Syria
  • Ukraine
  • Venezuela
Message:
0/2000
Accept quotations from other qualified suppliers on ECHEMI.com

All products displayed on this website are only for non-medical purposes such as industrial applications or scientific research, and cannot be used for clinical diagnosis or treatment of humans or animals. They are not medicinal or edible.

According to relevant laws and regulations and the regulations of this website, units or individuals who purchase hazardous materials should obtain valid qualifications and qualification conditions.

The information shown above is provided by the enterprise itself, and the authenticity, accuracy and legitimacy of the content are the responsibility of the publishing company. ECHEMI does not bear any guarantee responsibility for this. Please be aware that risks in internet transactions objectively exist.

Feedback & Suggestions
Send Message

Thank you for your feedback. If you require further assistance, please contact us by email at info@echemi.com or call us at +86-532-55729510.